First European Erwinia amylovora Lytic Bacteriophage Cocktails Effective in the Host: Characterization and Prospects for Fire Blight Biocontrol.

Fire blight, caused by the plant-pathogenic bacterium Erwinia amylovora, is a highly contagious and difficult-to-control disease due to its efficient dissemination and survival and the scarcity of effective control methods. Copper and antibiotics are the most used treatments but pose environmental and human health risks. Bacteriophages (phages) constitute an ecological, safe, and sustainable fire blight control alternative. The goal of this study was to search for specific E. amylovora phages from plant material, soil, and water samples in Mediterranean environments. A collection of phages able to specifically infect and lyse E. amylovora strains was generated from former fire blight-affected orchards in Eastern Spain. Following in vitro characterization, assays in immature fruit revealed that preventively applying some of the phages or their combinations delayed the onset of fire blight symptoms and reduced the disease's severity, suggesting their biocontrol potential in Spain and other countries. The morphological and molecular characterization of the selected E. amylovora phages classified them as members of the class Caudoviricetes (former Myoviridae family) and genus Kolesnikvirus. This study reveals Mediterranean settings as plausible sources of E. amylovora-specific bacteriophages and provides the first effective European phage cocktails in plant material for the development of sustainable fire blight management measures.

Complete Genome Characterization of Penicillimonavirus gammaplasmoparae, a Bipartite Member of the Family Mymonaviridae.

In this study, we identified Plasmopara-viticola-lesion-associated mononegaambi virus 3 (recently classified as Penicillimonavirus gammaplasmoparae), a fungi-associated mymonavirus, in grapevine plants showing an unusual upward curling symptomatology on the leaves and premature decline. Mymonaviridae is a family comprising nine genera of negative-sense single-stranded RNA viruses infecting filamentous fungi, although few of them have been associated with oomycetes, plants, and insects. Although the first mymonavirus genome description was reported a decade ago, the genome organization of several genera in the family, including the genus Penicillimonavirus, has remained unclear to date. We have determined the complete genome of P. gammaplasmoparae, which represents the first complete genomic sequence for this genus. Moreover, we provide strong evidence that P. gammaplasmoparae genome is bipartite and comprises two RNA molecules of around 6150 and 4560 nt. Our results indicate that the grapevine powdery mildew pathogen, Erysiphe necator, was also present in the analyzed plants and suggest P. gammaplasmoparae could be infecting this fungus. However, whether the fungus and/or the mycovirus are associated with the symptomatology that initially prompted these efforts remains to be determined.

Real-time on-site detection of the three 'Candidatus Liberibacter' species associated with HLB disease: a rapid and validated method.

Huanglongbing (HLB) is a devastating disease that affects all commercial citrus species worldwide. The disease is associated with bacteria of three species of the genus 'Candidatus Liberibacter' transmitted by psyllid vectors. To date, HLB has no cure, so preventing its introduction into HLB-free areas is the best strategy to control its spread. For that, the use of accurate, sensitive, specific, and reliable detection methods is critical for good integrated management of this serious disease. This study presents a new real-time recombinase polymerase amplification (RPA) protocol able to detect the three 'Ca. Liberibacter' species associated with HLB in both plant and insect samples, validated according to European and Mediterranean Plant Protection Organization (EPPO) guidelines and tested on 365 samples from nine different geographic origins. This new protocol does not require nucleic acid purification or specialized equipment, making it ideal to be used under field conditions. It is based on specific primers and probe targeting a region of fusA gene, which shows a specificity of 94%-100%, both in silico and in vitro, for the 'Ca. Liberibacter' species associated with HLB. The analytical sensitivity of the new protocol is excellent, with a reliable detection limit in the order of 101 copies per microliter in HLB-infected plant and insect material. The repeatability and reproducibility of the new methods showed consistent results. Diagnostic parameters of the new RPA protocol were calculated and compared with the gold standard technique, a quantitative real-time PCR, in both crude extracts of citrus plants and insect vectors. The agreement between the two techniques was almost perfect according to the estimated Cohen's kappa index, with a diagnostic sensitivity and specificity of 83.89% and 100%, respectively, and a relative accuracy of 91.59%. Moreover, the results are obtained in less than 35 min. All these results indicate the potential of this new RPA protocol to be implemented as a reliable on-site detection kit for HLB due to its simplicity, speed, and portability.

A Novel and Highly Inclusive Quantitative Real-Time RT-PCR Method for the Broad and Efficient Detection of Grapevine Leafroll-Associated Virus 1.

Grapevine (Vitis vinifera L.) is one of the most important crops in the world due to its economic and social impact. Like many other crops, grapevine is susceptible to different types of diseases caused by pathogenic microorganisms. Grapevine leafroll-associated virus 1 (GLRaV-1) is a virus associated with grapevine leafroll disease and it is considered at the national and European level as a pathogen that must be absent in propagative plant material. For this reason, the availability of specific, sensitive and reliable detection techniques to ascertain the sanitary status of the plants is of great importance. The objective of this research was the development of a new GLRaV-1 detection method based on a TaqMan quantitative real-time RT-PCR targeted to the coat protein genomic region and including a host internal control in a duplex reaction. To this end, three new GLRaV-1 full genomes were recovered by HTS and aligned with all sequences available in the databases. The method has been validated following EPPO standards and applied for the diagnosis of field plant material and transmission vectors. The new protocol designed has turned out to be highly sensitive as well as much more specific than the current available methods for the detection and absolute quantitation of GLRaV-1 viral titer.

A new and accurate qPCR protocol to detect plant pathogenic bacteria of the genus 'Candidatus Liberibacter' in plants and insects.

Four pathogenic bacterial species of the genus 'Candidatus Liberibacter', transmitted by psyllid vectors, have been associated with serious diseases affecting economically important crops of Rutaceae, Apiaceae and Solanaceae families. The most severe disease of citrus plants, huanglongbing (HLB), is associated with 'Ca. Liberibacter asiaticus' (CaLas), 'Ca. Liberibacter americanus' (CaLam) and 'Ca. Liberibacter africanus' (CaLaf), while 'Ca. Liberibacter solanacearum' (CaLsol) is associated with zebra chip disease in potatoes and vegetative disorders in apiaceous plants. Since these bacteria remain non-culturable and their symptoms are non-specific, their detection and identification are done by molecular methods, mainly based on PCR protocols. In this study, a new quantitative real-time PCR protocol based on TaqMan probe, which can also be performed in a conventional PCR version, has been developed to detect the four known phytopathogenic species of the genus Liberibacter. The new protocol has been validated according to European Plant Protection Organization (EPPO) guidelines and is able to detect CaLas, CaLam, CaLaf and CaLsol in both plants and vectors, not only using purified DNA but also using crude extracts of potato and citrus or psyllids. A comparative analysis with other previously described qPCR protocols revealed that this new one developed in this study is more specific and equally or more sensitive. Thus, other genus-specific qPCR protocols have important drawbacks regarding the lack of specificity, while with the new protocol there was no cross-reactions in 250 samples from 24 different plant and insect species from eight different geographical origins. Therefore, it can be used as a rapid and time-saving screening test, as it allows simultaneous detection of all plant pathogenic species of 'Ca. Liberibacter' in a one-step assay.

Characterization of Spanish Olive Virome by High Throughput Sequencing Opens New Insights and Uncertainties.

The use of high throughput sequencing (HTS) for the analysis of Spanish olive trees showing leaf yellowing discoloration, defoliation, and/or decline has provided new insights into the olive viruses present in Spain and has opened discussions about the pros and cons of these technologies for diagnostic purposes. In this study, we report for the first time in Spanish orchards the presence of olive leaf yellowing-associated virus (OLYaV), for which the second full coding sequence has been determined. This virus has also been detected in a putative vector, the psyllid Euphyllura olivina. In addition, the presence in Spain of Olea europaea geminivirus (OEGV), recently reported in Italy, has been confirmed, and the full-length sequence of two isolates was obtained by HTS and Sanger sequencing. These results, as well as the detection of other viral sequences related to olive latent virus 3 (OLV-3) and olive viral satellite RNA, raises questions on the biological significance of the findings, about the requirement of standardization on the interpretation of HTS results, and the necessity of additional tests to confirm the relevance of the HTS detection of viral sequences.

First Detection and Molecular Characterization of Apple Stem Grooving Virus, Apple Chlorotic Leaf Spot Virus, and Apple Hammerhead Viroid in Loquat in Spain.

Loquat (Eriobotrya japonica) is an important crop in Spain. To date, only one viral species, apple stem pitting virus (ASPV), has been detected in Spanish loquat orchards. In this study, the presence of additional viruses infecting this crop in Spain was investigated. RT-PCR and high-throughput sequencing (HTS) of symptomatic loquat plants led to first-time detection and characterization of apple stem grooving virus (ASGV), also known as citrus tatter leaf virus (CTLV), and apple chlorotic leaf spot virus (ACLSV) from Spain with description of nearly complete genomic sequences. The frequency of ACLSV infection was the highest, with over 30% of the samples testing positive and were also detected as coinfections with ASGV and ASPV, although most of the samples infected were symptomless. Studies on all the full-length sequences available in the databases were performed in order to establish the phylogenetic relationships of the Spanish isolates of these two viral species. Moreover, apple hammerhead viroid (AHVd) was also detected to infect loquat, the first host different from apple reported for this viroid to date.

Loquat (Eriobotrya japonica) is a New Natural Host of Apple Stem Pitting Virus.

Loquat (Eriobotrya japonica) is a minor but important woody crop cultivated in Asia and Europe. High-throughput sequencing (HTS) analysis of an asymptomatic loquat plant using RNAseq Illumina technology has allowed the detection for the first time of apple stem pitting virus (ASPV), the type species of the genus Foveavirus in the family Betaflexiviridae, infecting this crop. A nearly complete genome of 9303 nts (ASPV-SL61) reconstructed bioinformatically shows the typical genomic structure of this viral species and a highest nucleotide identity (85.9%) with the Chinese ASPV isolate YLX from pear. A close phylogenetic relationship between ASPV-SL61 and ASPV-YLX has been confirmed by the sequence analysis of full-length ASPV genomic sequences available in the databases. In fact, a phylogenetic study based on a partial CP N-terminal sequence previously proposed to be involved in host adaptation has shown that ASPV-SL61 loquat isolate is more closely related to ASPV pear isolates. The presence of ASPV in loquat has been further confirmed by RT-PCR and Sanger sequencing and DAS-ELISA. An incidence of 15% was determined in one of the loquat Spanish growing areas. The sequence analysis of the partial CP sequences amplified by RT-PCR has shown a high level of variability between loquat isolates. To our knowledge, this is the first record of loquat as a natural host of ASPV.

Molecular Characterization of the Complete Coding Sequence of Olive Leaf Yellowing-Associated Virus.

Genome organization and phylogenetic relationships of olive leaf yellowing-associated virus (OLYaV) with other members of the Closteroviridae family were determined. The complete coding sequence of OLYaV was obtained by high throughput sequencing of total RNA from a 35-year-old olive tree (cv. Zarzaleña) from Brazil, showing olive leaf yellowing disease and deformations in the wood. This represents the first report of OLYaV in this country. A genomic sequence of 16,700 nt containing 11 open reading frames (ORFs) was recovered, representing the complete virus coding capacity. The knowledge of the nucleotide sequence of the genome including the gene that codes the coat protein will facilitate the development of diagnostic tests, which are limited so far to PCR-based methods targeting the HSP70h gene. Interestingly, a thaumatin-like protein (ORF2), previously reported in other unassigned viruses in the Closteroviridae family, persimmon virus B and actidinia virus 1, was identified in the OLYaV genome. Phylogenetic analysis of shared proteins (ORF1a, ORF1b, HSP70h, HSP90h and CP) with all members of the Closteroviridae family provides new insight into the taxonomic position of these three closteroviruses and suggests they could represent a new genus in the family.

First report of Grapevine asteroid mosaic associated virus in grapevine in Spain.

Grapevine asteroid mosaic associated virus (GAMaV) is a member of the genus Marafivirus, family Tymoviridae. GAMaV was initially found to infect grapevine (Vitis vinifera) in California and was also reported in Japan, Canada, Uruguay, France, Hungary and Italy (Nakaune et al. 2008; Vargas-Asencio et al. 2017; Candresse et al. 2017; Porceddu et al. 2018). In July 2019 a grapevine sample from cv. Tempranillo (TS1), collected in a random survey from a vineyard in a Spanish grapevine growing area (D.O. Utiel-Requena), showing chlorotic mottling and leaf deformations, was analyzed by high throughput sequencing (HTS). Total RNA extracted from leaves was sequenced after ribo-depletion (Ribo-Zero Plant kit, Illumina) using TrueSeq Illumina technology (150 nt pair-end reads). Data analysis was performed by CLC Genomics Workbench 10.1.1. After quality control and host genome subtraction 2,410,654 reads were used for de novo assembly. BLAST analysis of the 13,303 contigs obtained revealed the presence of four contigs (2736, 1448, 1285 and 954 nt in size) related to GAMaV, indicating the presence of this virus in TS1 sample. Contigs related to other viruses/viroids were also found, in particular Grapevine rupestris stem pitting-associated virus, Grapevine leafroll-associated virus 3, Grapevine virus A, Grapevine fleck virus, Grapevine red globe virus, Grapevine rupestris vein feathering virus and Hop stunt viroid. For the assembly of the full-length GAMaV genome, contigs were extended by mapping the reads against the contigs using Geneious Prime 2020 software. This mapping step allowed the recovery of the GAMaV genomic sequence (635 reads, average coverage per nucleotide 10.0) with the exception of a small gap of 147 nt in the helicase region of the polyprotein. The gap in the genomic region was covered by RT-PCR using two newly designed primers overlapping the flanking regions (GAMaV-3755-F, 5'ATCCTCACCAACTCCC3' and GAMaV-3985-R, 5'GTTGGAAGTGGTGTG3'). Nearly complete sequence of the isolate TS1 (6,692 nt, MT459830) showed 87.7% nucleotide identity with the isolate 16GVP031 (MK253012) from France. The phylogenetic analysis performed on the available GAMaV full-length genomes showed that the Spanish isolate was positioned in a distinct clade (Supp. Fig. 1). The presence of GAMaV in Spain was further evaluated by reverse transcription-polymerase chain reaction (RT-PCR). Specific GAMaV primers, GAMaV-F3 and GAMaV-R3 previously reported by Candresse et al. (2017) were used without any success, due to primer mismatching. Based on TS1 sequence, two primers (GAMaV-6010F, 5'CCCTCCTCCTAGCGACGACC3' and GAMaV-6426R, 5'GGGTTGAGACGGCGGAGATC3') were designed and used to amplify a fragment of 417 nt in the CP region. Sanger sequencing of the obtained RT-PCR product confirmed the HTS recovered sequence. A total of 52 randomly collected samples from the same grapevine growing area were analyzed by RT-PCR using the newly designed primers. One sample bearing similar symptoms, TS7 (MT770919, cv. Tempranillo), and eight symptomless samples, MS1, MS2 and MS3 (MT770911, MT770917 and MT770918, cv. Macabeo), and TS2, TS3, TS4, TS5 and TS6 (MT770912, MT770913, MT770914, MT770915 and MT770916, cv. Tempranillo), tested positive for GAMaV, thus confirming its presence in Spanish vineyards. The nucleotide identity between these partial sequences and the homologous region of TS1 ranged from 94.7% to 98.8%, 0.04 being the mean diversity among isolates at the CP genomic region estimated by MEGA X software. To our knowledge, this is the first report of GAMaV in grapevine in Spain. The presence of other viruses/viroids in TS1 sample and the finding of asymptomatic GAMaV infected plants make difficult to associate this virus to the observed symptomatology. Other latent or semilatent GAMaV infections have been previously reported (Martelli 2014; Candresse et al. 2017).

Specific Real-Time PCR for the Detection and Absolute Quantitation of Grapevine Roditis Leaf Discoloration-Associated Virus, an EPPO Alert Pathogen.

Grapevine Roditis leaf discoloration-associated virus (GRLDaV) is an emerging grapevine pathogen included in the European and Mediterranean Plant Protection Organization (EPPO) alert list due to its ability to damage grapevine crops and cause production losses. This work aimed to develop a specific and reliable diagnostic tool that would contribute to preventing the spread of this pathogen. Therefore, a TaqMan real-time quantitative PCR was developed. The method was validated according to EPPO guidelines showing a high degree of analytical sensitivity, analytical specificity, selectivity, and repeatability and reproducibility. The sensitivity of this method is much higher than the sensitivity reached by previously reported methods even when tested in crude extracts, which could allow rapid testing by avoiding nucleic acid extraction steps. The method was also able to detect GRLDaV isolates from all the geographic origins reported so far, despite their high degree of genetic diversity. In addition, this new technique has been successfully applied for the quantitative detection of GRLDaV in plant material and two mealybug species, Planococcus citri and Pseudococcus viburni. In conclusion, the methodology developed herein represents a significant contribution to the diagnosis and control of this emerging pathogen in grapevine.

Development of a real-time PCR method for the specific detection of the novel pear pathogen Erwinia uzenensis.

Erwinia uzenensis is a plant-pathogenic bacterium, recently described in Japan, which infects pear trees, causing the 'bacterial black shoot disease of European pear' (BBSDP). Like other Erwinia pear pathogens, E. uzenensis causes damp, black lesions on young shoots resembling those of E. amylovora, but not blossom blight, fruitlet blight or wilting of the shoot tip. The distribution of E. uzenensis seems restricted to the country where it was reported up to now, but it may spread to other countries and affect new hosts, as is the current situation with E. piriflorinigrans and E. pyrifoliae. Fast and accurate detection systems for this new pathogen are needed to study its biology and to identify it on pear or other hosts. We report here the development of a specific and sensitive detection protocol based on a real-time PCR with a TaqMan probe for E. uzenensis, and its evaluation. In sensitivity assays, the detection threshold of this protocol was 101 cfu ml-1 on pure bacterial cultures and 102-103 cfu ml-1 on spiked plant material. The specificity of the protocol was evaluated against E. uzenensis and 46 strains of pear-associated Erwinia species different to E. uzenensis. No cross-reaction with the non-target bacterial species or the loss of sensitivity were observed. This specific and sensitive diagnostic tool may reveal a wider distribution and host range of E. uzenensis initially considered restricted to a region and will expand our knowledge of the life cycle and environmental preferences of this pathogen.

A novel specific duplex real-time RT-PCR method for absolute quantitation of Grapevine Pinot gris virus in plant material and single mites.

Grapevine Pinot gris virus (GPGV) is a widely distributed grapevine pathogen that has been associated to the grapevine leaf mottling and deformation disease. With the aim of better understanding the disease epidemiology and providing efficient control strategies a specific and quantitative duplex TaqMan real-time RT-PCR assay has been developed. This method has allowed reliable quantitation of the GPGV titer ranging from 30 up to 3 x 108 transcript copies, with a detection limit of 70 viral copies in plant material. The assay targets a grapevine internal control that reduces the occurrence of false negative results, thus increasing the diagnostic sensitivity of the technique. Viral isolates both associated and non-associated to symptoms from Greece, Slovakia and Spain have been successfully detected. The method has also been applied to the absolute quantitation of GPGV in its putative transmission vector Colomerus vitis. Moreover, the viral titer present in single mites has been determined. In addition, in the current study a new polymorphism in the GPGV genome responsible for a shorter movement protein has been found. A phylogenetic study based on this genomic region has shown a high variability among Spanish isolates and points to a different evolutionary origin of this new polymorphism. The methodology here developed opens new possibilities for basic and epidemiological studies as well as for the establishment of efficient control strategies.